ID: 1163587722_1163587731

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1163587722 1163587731
Species Human (GRCh38) Human (GRCh38)
Location 19:18173161-18173183 19:18173204-18173226
Sequence CCAGCTTCTGCTTTCCGGCGTGG GTCCCACGGGACCACGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117} {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!