ID: 1163622842_1163622847

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1163622842 1163622847
Species Human (GRCh38) Human (GRCh38)
Location 19:18371029-18371051 19:18371060-18371082
Sequence CCAGCTACTTGGGAGGCTGAGGC CACTTGAACCCGGCGGGTGGAGG
Strand - +
Off-target summary {0: 81212, 1: 190903, 2: 234468, 3: 228974, 4: 272812} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!