ID: 1163865598_1163865604

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1163865598 1163865604
Species Human (GRCh38) Human (GRCh38)
Location 19:19770489-19770511 19:19770523-19770545
Sequence CCTTGGGATGCTGTTAATCTATA AACCCCGTGCTCTCTGAAACAGG
Strand - +
Off-target summary {0: 464, 1: 169, 2: 591, 3: 458, 4: 1243} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!