ID: 1163910592_1163910598

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1163910592 1163910598
Species Human (GRCh38) Human (GRCh38)
Location 19:20187851-20187873 19:20187872-20187894
Sequence CCCTTAGGGTGATGAGATGCCCT CTCTGAATTTGTAGTGGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 12, 2: 14, 3: 295, 4: 12960}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!