ID: 1164179660_1164179674

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1164179660 1164179674
Species Human (GRCh38) Human (GRCh38)
Location 19:22807535-22807557 19:22807576-22807598
Sequence CCAAGGCGGGGGCCGCCCACGAC CGGGGGCAAATTTCCCAGAGCGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 0, 3: 6, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!