ID: 1164226514_1164226518

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1164226514 1164226518
Species Human (GRCh38) Human (GRCh38)
Location 19:23250560-23250582 19:23250592-23250614
Sequence CCTAAGCTGCAGCGTTTTCAGGC TCCCTGAGCTTAGCCCACCCCGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 13, 3: 24, 4: 367} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!