ID: 1164288323_1164288327

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1164288323 1164288327
Species Human (GRCh38) Human (GRCh38)
Location 19:23842482-23842504 19:23842527-23842549
Sequence CCTAGAGTAAAATTAACAATTCT TGTGTGTTTTTTTTTTTTTTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!