ID: 1164306042_1164306048

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1164306042 1164306048
Species Human (GRCh38) Human (GRCh38)
Location 19:24004277-24004299 19:24004300-24004322
Sequence CCAACGAGCCCTGCAAGGGAACC GCCAGCCATGCACCCCTGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 22, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!