ID: 1164493705_1164493711

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1164493705 1164493711
Species Human (GRCh38) Human (GRCh38)
Location 19:28737925-28737947 19:28737976-28737998
Sequence CCACATGTTACTAGGGTGAAACT GACCACAACTCACACAGGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!