ID: 1164493708_1164493714

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1164493708 1164493714
Species Human (GRCh38) Human (GRCh38)
Location 19:28737960-28737982 19:28737985-28738007
Sequence CCAAGAGTTAAACGATGACCACA TCACACAGGGATGGGAGACATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!