ID: 1164576262_1164576270

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1164576262 1164576270
Species Human (GRCh38) Human (GRCh38)
Location 19:29407140-29407162 19:29407170-29407192
Sequence CCAGAAATGCTTGCCCCTTCCTC CCTGGCTCCCCCGATCCCTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!