ID: 1164648137_1164648146

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1164648137 1164648146
Species Human (GRCh38) Human (GRCh38)
Location 19:29873744-29873766 19:29873761-29873783
Sequence CCAGCGCCCCCGCGCCCCCGCGC CCGCGCCCGCGCCGCTCTCCCGG
Strand - +
Off-target summary {0: 6, 1: 6, 2: 31, 3: 276, 4: 1575} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!