ID: 1164649667_1164649670

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1164649667 1164649670
Species Human (GRCh38) Human (GRCh38)
Location 19:29882759-29882781 19:29882775-29882797
Sequence CCCGCTGGTGGGGAGAAAGGGCC AAGGGCCTTGCTTGGTCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 241} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!