ID: 1164706288_1164706294

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1164706288 1164706294
Species Human (GRCh38) Human (GRCh38)
Location 19:30322761-30322783 19:30322777-30322799
Sequence CCTCCTGCCCACCGAGCCCCTTA CCCCTTACTCTCACTCCTAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 9, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!