ID: 1164706288_1164706302

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1164706288 1164706302
Species Human (GRCh38) Human (GRCh38)
Location 19:30322761-30322783 19:30322797-30322819
Sequence CCTCCTGCCCACCGAGCCCCTTA TGGGGGCCTCAGATGGCCTGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 29, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!