ID: 1164736997_1164736999

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1164736997 1164736999
Species Human (GRCh38) Human (GRCh38)
Location 19:30548941-30548963 19:30548956-30548978
Sequence CCATCAGACTTCTACAAGCAGTT AAGCAGTTTGGTGTTTACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128} {0: 1, 1: 0, 2: 2, 3: 33, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!