ID: 1164828999_1164829007

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1164828999 1164829007
Species Human (GRCh38) Human (GRCh38)
Location 19:31306123-31306145 19:31306149-31306171
Sequence CCTCCCCACGAGACGACGGCACA ACCGTGTGCGCTCATTCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34} {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!