ID: 1164922885_1164922894

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1164922885 1164922894
Species Human (GRCh38) Human (GRCh38)
Location 19:32102879-32102901 19:32102928-32102950
Sequence CCTGGGAAGACTGTCAGTGCCCC TTCCTGCCATTCTCCCACCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 70, 4: 905}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!