ID: 1164976984_1164976987

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1164976984 1164976987
Species Human (GRCh38) Human (GRCh38)
Location 19:32581015-32581037 19:32581035-32581057
Sequence CCGATCACGGGTGGGAGGTGGAT GATCCCGGAGGCCCCGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 105} {0: 1, 1: 0, 2: 3, 3: 29, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!