ID: 1165016293_1165016296

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1165016293 1165016296
Species Human (GRCh38) Human (GRCh38)
Location 19:32882653-32882675 19:32882672-32882694
Sequence CCCTGCATCAACTGGTAACCTAA CTAAGAACTAATGCTGCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78} {0: 1, 1: 0, 2: 1, 3: 7, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!