ID: 1165042122_1165042123

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1165042122 1165042123
Species Human (GRCh38) Human (GRCh38)
Location 19:33076053-33076075 19:33076084-33076106
Sequence CCTGGGCAACACTGCAAAATTGC AAAAAATACAAGTATTAGCCAGG
Strand - +
Off-target summary No data {0: 5, 1: 216, 2: 12629, 3: 104182, 4: 158045}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!