ID: 1165042122_1165042124

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1165042122 1165042124
Species Human (GRCh38) Human (GRCh38)
Location 19:33076053-33076075 19:33076089-33076111
Sequence CCTGGGCAACACTGCAAAATTGC ATACAAGTATTAGCCAGGCATGG
Strand - +
Off-target summary No data {0: 4, 1: 254, 2: 20746, 3: 48640, 4: 95579}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!