ID: 1165077514_1165077518

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1165077514 1165077518
Species Human (GRCh38) Human (GRCh38)
Location 19:33288405-33288427 19:33288422-33288444
Sequence CCACCAGGCCAAAATTGAGGAGA AGGAGAAAAGGAATCCAGACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!