ID: 1165113290_1165113297

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1165113290 1165113297
Species Human (GRCh38) Human (GRCh38)
Location 19:33514273-33514295 19:33514317-33514339
Sequence CCTGGGGACTGCAGTGAAGCTGT CACAGCACGGTGAAGTGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 216} {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!