ID: 1165141144_1165141152

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1165141144 1165141152
Species Human (GRCh38) Human (GRCh38)
Location 19:33700685-33700707 19:33700707-33700729
Sequence CCTCCTAGGCCAGGCCAGCCATC CATTATGCACAATTGGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 277} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!