ID: 1165211126_1165211129

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1165211126 1165211129
Species Human (GRCh38) Human (GRCh38)
Location 19:34236648-34236670 19:34236671-34236693
Sequence CCAGTTCTGGGAATGGCGGGAAC CCTCCTGAAATCCAGATGTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!