ID: 1165258604_1165258609

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1165258604 1165258609
Species Human (GRCh38) Human (GRCh38)
Location 19:34595175-34595197 19:34595190-34595212
Sequence CCAGCCTCAACACTACCCGTAGG CCCGTAGGGTACCCGAAGTCTGG
Strand - +
Off-target summary {0: 2, 1: 17, 2: 24, 3: 18, 4: 61} {0: 4, 1: 14, 2: 17, 3: 8, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!