ID: 1165285591_1165285604

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1165285591 1165285604
Species Human (GRCh38) Human (GRCh38)
Location 19:34839116-34839138 19:34839166-34839188
Sequence CCCAGCCCCAGCAGGGGACTCTC GCGGCTGTTTAGACCCAGACCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!