ID: 1165338093_1165338100

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1165338093 1165338100
Species Human (GRCh38) Human (GRCh38)
Location 19:35187314-35187336 19:35187346-35187368
Sequence CCAACTACTCGGGAACCTGAGGC CCCTTGAACCTGGGAGGCAGAGG
Strand - +
Off-target summary No data {0: 423, 1: 19465, 2: 58168, 3: 109530, 4: 133258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!