ID: 1165370181_1165370187

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1165370181 1165370187
Species Human (GRCh38) Human (GRCh38)
Location 19:35400466-35400488 19:35400504-35400526
Sequence CCAGCCTGGGCAACACAGTGAGA GAAAGAAAAAAGAAGGAAGGAGG
Strand - +
Off-target summary {0: 3138, 1: 40460, 2: 101153, 3: 213792, 4: 342817} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!