ID: 1165370182_1165370187

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1165370182 1165370187
Species Human (GRCh38) Human (GRCh38)
Location 19:35400470-35400492 19:35400504-35400526
Sequence CCTGGGCAACACAGTGAGATCCT GAAAGAAAAAAGAAGGAAGGAGG
Strand - +
Off-target summary {0: 122, 1: 2484, 2: 16445, 3: 51376, 4: 125114} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!