ID: 1165466333_1165466342

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1165466333 1165466342
Species Human (GRCh38) Human (GRCh38)
Location 19:35977201-35977223 19:35977242-35977264
Sequence CCAGGATGGCAGACCCTCACTGC CCTTGTACTTCCCGTGATGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!