ID: 1165618754_1165618759

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1165618754 1165618759
Species Human (GRCh38) Human (GRCh38)
Location 19:37226341-37226363 19:37226382-37226404
Sequence CCCACATGGACACTCAGAGTCTA ACTCCTGGTGTTACACATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124} {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!