ID: 1165645051_1165645056

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1165645051 1165645056
Species Human (GRCh38) Human (GRCh38)
Location 19:37428756-37428778 19:37428796-37428818
Sequence CCTCCGTCTCCTGGATTCAAGTG TCCCAAATAGCTAGAACTACAGG
Strand - +
Off-target summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} {0: 11, 1: 531, 2: 8015, 3: 69954, 4: 236570}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!