|
Left Crispr |
Right Crispr |
| Crispr ID |
1165731272 |
1165731278 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:38147135-38147157
|
19:38147174-38147196
|
| Sequence |
CCCTGCAACTTCTGCCTCCCAGG |
GCCTCAACCTCCCATGAAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 1, 1: 68, 2: 4252, 3: 99199, 4: 215590} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|