ID: 1165824418_1165824424

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1165824418 1165824424
Species Human (GRCh38) Human (GRCh38)
Location 19:38697726-38697748 19:38697746-38697768
Sequence CCTTGCCCTCGGGGAACAGCCCT CCTCTTTTGTCCTCAGGCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 36, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!