ID: 1165831013_1165831028

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1165831013 1165831028
Species Human (GRCh38) Human (GRCh38)
Location 19:38730329-38730351 19:38730369-38730391
Sequence CCTCCGGGTCTGCGTCGGGCGTG CAGAGGTGGAGGTGGGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 47} {0: 1, 1: 0, 2: 13, 3: 92, 4: 924}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!