ID: 1165904489_1165904504

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1165904489 1165904504
Species Human (GRCh38) Human (GRCh38)
Location 19:39185393-39185415 19:39185440-39185462
Sequence CCTAGGGTGATCCATGGAGACTT GATGAGATGGGGCAGCAAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 26, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!