ID: 1165924882_1165924898

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1165924882 1165924898
Species Human (GRCh38) Human (GRCh38)
Location 19:39320792-39320814 19:39320831-39320853
Sequence CCCAGCCCGGGGGGGCCCCGGGC TGCCTCGCTCCGCGCCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 397} {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!