ID: 1165924890_1165924903

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1165924890 1165924903
Species Human (GRCh38) Human (GRCh38)
Location 19:39320814-39320836 19:39320835-39320857
Sequence CCCGGCCCCGCCGCCGCTGCCTC TCGCTCCGCGCCATGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 39, 3: 286, 4: 1551} {0: 1, 1: 0, 2: 0, 3: 6, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!