ID: 1165924890_1165924912

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1165924890 1165924912
Species Human (GRCh38) Human (GRCh38)
Location 19:39320814-39320836 19:39320849-39320871
Sequence CCCGGCCCCGCCGCCGCTGCCTC GGTGGGGGGAGGGCCGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 39, 3: 286, 4: 1551} {0: 1, 1: 5, 2: 58, 3: 823, 4: 5880}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!