ID: 1165924895_1165924920

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1165924895 1165924920
Species Human (GRCh38) Human (GRCh38)
Location 19:39320824-39320846 19:39320867-39320889
Sequence CCGCCGCTGCCTCGCTCCGCGCC GGAGGGGGCGCGGTGCCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 39, 4: 450} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!