ID: 1166040090_1166040098

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1166040090 1166040098
Species Human (GRCh38) Human (GRCh38)
Location 19:40197074-40197096 19:40197105-40197127
Sequence CCTGCATTTGCGGACCAGCTGGA TGATGGAGGCTGGGCTCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 98} {0: 1, 1: 0, 2: 23, 3: 98, 4: 539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!