ID: 1166107666_1166107678

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1166107666 1166107678
Species Human (GRCh38) Human (GRCh38)
Location 19:40605378-40605400 19:40605424-40605446
Sequence CCGTTTGCCCGGCCGTGCCTCCC CGTCCACGTGGAGCACCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 226} {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!