ID: 1166137570_1166137580

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1166137570 1166137580
Species Human (GRCh38) Human (GRCh38)
Location 19:40786642-40786664 19:40786693-40786715
Sequence CCTCAGAGTGTGTGCCCCTGCAG CACAGGCGAGAACGTGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 269} {0: 1, 1: 0, 2: 0, 3: 21, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!