ID: 1166137574_1166137580

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1166137574 1166137580
Species Human (GRCh38) Human (GRCh38)
Location 19:40786658-40786680 19:40786693-40786715
Sequence CCTGCAGAGCTGATGTTCCTGGA CACAGGCGAGAACGTGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 239} {0: 1, 1: 0, 2: 0, 3: 21, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!