ID: 1166165652_1166165661

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1166165652 1166165661
Species Human (GRCh38) Human (GRCh38)
Location 19:40986551-40986573 19:40986589-40986611
Sequence CCTTGCTGGGTCAGGAGTGCAGC TCTGGAGGGGTGGAAGTCAGTGG
Strand - +
Off-target summary No data {0: 18, 1: 83, 2: 109, 3: 126, 4: 466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!