ID: 1166176787_1166176795

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1166176787 1166176795
Species Human (GRCh38) Human (GRCh38)
Location 19:41078875-41078897 19:41078921-41078943
Sequence CCAGATCTCATTTAAACTGAGTG ATGGCACTAAGCCATTCATGAGG
Strand - +
Off-target summary No data {0: 58, 1: 255, 2: 820, 3: 1635, 4: 2231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!