ID: 1166185523_1166185531

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1166185523 1166185531
Species Human (GRCh38) Human (GRCh38)
Location 19:41136514-41136536 19:41136553-41136575
Sequence CCAGCCTTATGCCAAATCCCGAG CAATGGGACAGTTAGATTCTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 68} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!