ID: 1166185524_1166185529

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1166185524 1166185529
Species Human (GRCh38) Human (GRCh38)
Location 19:41136518-41136540 19:41136537-41136559
Sequence CCTTATGCCAAATCCCGAGTACA TACACAGACGTACCTACAATGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 60} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!